The Concentration and Probabilistic Health Risk of Potentially Toxic Elements (PTEs) in Edible Mushrooms (Wild and Cultivated) Samples Collected from Different Cities of Iran

The present study was devoted to investigate the PTE concentrations including cadmium (Cd), chromium (Cr), copper(Cu), iron (Fe), mercury (Hg), manganese (Mn), nickel (Ni), lead (Pb), arsenic(As), and zinc (Zn) among six types of edible wild, 23 cultivated mushroom samples collected from Iran’s market by the aid of an inductively coupled plasma-optical emission spectrometry (ICP-OES).

Also, the related health risk assessment was established by the aid of the Monte Carlo simulation method (MSC). The limit of detection (LOD) and limit of quantification (LOQ) were ranged 0.001-0.048 and 0.003-0.160 ppm, respectively. The concentrations of As, Cd, Cr, Cu, Fe, Hg, Mn, Ni, Pb, and Zn were determined in the ranges of 0.003-11. 5, 0.0008-5.89, 0.32-26.32, 9.15-110.08, 15.25-751.17, 0.16-2.24, 2.1-60.47, 1.21-24.22, 0.16-8.92, and 37.13-268.11 mg kg-1, respectively.

According to findings, highest mean concentration of Cr in both types of mushrooms (cultivated and wild) was lower than recommended level by Codex Alimentarius/FoodandAgricultureOrganization/World Health Organization (CODEX/FAO/WHO) while the corresponding values for Hg (0.87 mg kg-1), As (1.39 mg kg-1), Ni (10.08 mg kg-1), Cu (36.65 mg kg-1), Cr (10.44 mg kg-1), Cd (0.589 mg kg-1), Fe (201.04 mg kg-1), Mn (10.30 mg kg-1), Zn (2266.43 mg kg-1), and Pb (3.81 mg kg-1) were higher than related standard levels.

According to the health risk assessment, no concern regarding the non-carcinogenic risk due to the ingestion of PTEs via the consumption of the edible mushrooms, except Hg in wild mushrooms for children, was noted.

ADAMTSL2 Antibody

36046-100ul 100ul
EUR 252

ADAMTSL2 antibody

70R-12642 100 ul
EUR 457
Description: Affinity purified Rabbit polyclonal ADAMTSL2 antibody

ADAMTSL2 Antibody

  • EUR 317.00
  • EUR 244.00
  • 100ul
  • 50ul
  • Form: Liquid
  • Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTSL2. Recognizes ADAMTSL2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADAMTSL2 Conjugated Antibody

C36046 100ul
EUR 397

ADAMTSL2 cloning plasmid

CSB-CL801225HU-10ug 10ug
EUR 558
  • Formulation: 10 μg plasmid + 200μl Glycerol
  • Length: 2856
  • Sequence: atggatggcagatggcaatgttcctgctgggcctggttcctgctggttctggcagttgtagctggggacacagtgtcaaccgggtccacggacaacagcccaacatccaatagcctggaggggggcaccgacgccacggccttctggtggggggagtggaccaagtggacggcgt
  • Show more
Description: A cloning plasmid for the ADAMTSL2 gene.

Anti-ADAMTSL2 antibody

STJ72031 100 µg
EUR 260

Mouse ADAMTSL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Human ADAMTSL2 shRNA Plasmid

  • EUR 801.00
  • EUR 1121.00
  • 150 µg
  • 300 µg
  • Shipped within 15-20 working days.

Polyclonal ADAMTSL2 Antibody (internal region)

APR14827G 0.1 mg
EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ADAMTSL2 (internal region). This antibody is tested and proven to work in the following applications:

ADAMTS Like 2 (ADAMTSL2) Antibody

abx432208-200ul 200 ul
EUR 286
  • Shipped within 1-3 working days.

ADAMTS Like 2 (ADAMTSL2) Antibody

  • EUR 411.00
  • EUR 300.00
  • 100 ul
  • 50 ul
  • Shipped within 5-10 working days.

ADAMTSL2 ORF Vector (Human) (pORF)

ORF000182 1.0 ug DNA
EUR 95

Adamtsl2 ORF Vector (Mouse) (pORF)

ORF038119 1.0 ug DNA
EUR 506

ADAMTSL2 ELISA Kit (Human) (OKCA01094)

OKCA01094 96 Wells
EUR 846
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.78 ng/mL

ADAMTSL2 sgRNA CRISPR Lentivector set (Human)

K0045601 3 x 1.0 ug
EUR 339

Adamtsl2 sgRNA CRISPR Lentivector set (Mouse)

K3545801 3 x 1.0 ug
EUR 339

ADAMTSL2 sgRNA CRISPR Lentivector (Human) (Target 1)

K0045602 1.0 ug DNA
EUR 154

ADAMTSL2 sgRNA CRISPR Lentivector (Human) (Target 2)

K0045603 1.0 ug DNA
EUR 154

ADAMTSL2 sgRNA CRISPR Lentivector (Human) (Target 3)

K0045604 1.0 ug DNA
EUR 154

Adamtsl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)

K3545802 1.0 ug DNA
EUR 154

Adamtsl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)

K3545803 1.0 ug DNA
EUR 154

Adamtsl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)

K3545804 1.0 ug DNA
EUR 154

ADAMTSL2 Protein Vector (Human) (pPB-C-His)

PV000725 500 ng
EUR 329

ADAMTSL2 Protein Vector (Human) (pPB-N-His)

PV000726 500 ng
EUR 329

ADAMTSL2 Protein Vector (Human) (pPM-C-HA)

PV000727 500 ng
EUR 329

ADAMTSL2 Protein Vector (Human) (pPM-C-His)

PV000728 500 ng
EUR 329

ADAMTSL2 Protein Vector (Human) (pPB-His-MBP)

PV319922 500 ng
EUR 329

ADAMTSL2 Protein Vector (Human) (pPB-His-GST)

PV319923 500 ng
EUR 329

ADAMTSL2 Protein Vector (Mouse) (pPB-C-His)

PV152474 500 ng
EUR 1065

ADAMTSL2 Protein Vector (Mouse) (pPB-N-His)

PV152475 500 ng
EUR 1065

ADAMTSL2 Protein Vector (Mouse) (pPM-C-HA)

PV152476 500 ng
EUR 1065

ADAMTSL2 Protein Vector (Mouse) (pPM-C-His)

PV152477 500 ng
EUR 1065

Adamtsl2 3'UTR Luciferase Stable Cell Line

TU200287 1.0 ml Ask for price

Adamtsl2 3'UTR GFP Stable Cell Line

TU151404 1.0 ml Ask for price

ADAMTSL2 3'UTR Luciferase Stable Cell Line

TU000336 1.0 ml
EUR 1394

Adamtsl2 3'UTR Luciferase Stable Cell Line

TU101404 1.0 ml Ask for price

ADAMTSL2 3'UTR GFP Stable Cell Line

TU050336 1.0 ml
EUR 1394

Adamtsl2 3'UTR GFP Stable Cell Line

TU250287 1.0 ml Ask for price

Goat ADAMTS like protein 2(ADAMTSL2) ELISA kit

E06A1249-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat ADAMTS like protein 2(ADAMTSL2) ELISA kit

E06A1249-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat ADAMTS like protein 2(ADAMTSL2) ELISA kit

E06A1249-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Goat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ADAMTS like protein 2(ADAMTSL2) ELISA kit

E02A1249-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ADAMTS like protein 2(ADAMTSL2) ELISA kit

E02A1249-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ADAMTS like protein 2(ADAMTSL2) ELISA kit

E02A1249-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ADAMTS like protein 2(ADAMTSL2) ELISA kit

E03A1249-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ADAMTS like protein 2(ADAMTSL2) ELISA kit

E03A1249-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ADAMTS like protein 2(ADAMTSL2) ELISA kit

E03A1249-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Mouse ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ADAMTS like protein 2(ADAMTSL2) ELISA kit

E04A1249-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ADAMTS like protein 2(ADAMTSL2) ELISA kit

E04A1249-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ADAMTS like protein 2(ADAMTSL2) ELISA kit

E04A1249-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAMTS like protein 2(ADAMTSL2) ELISA kit

E01A1249-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAMTS like protein 2(ADAMTSL2) ELISA kit

E01A1249-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAMTS like protein 2(ADAMTSL2) ELISA kit

E01A1249-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Human ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ADAMTS like protein 2(ADAMTSL2) ELISA kit

E08A1249-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ADAMTS like protein 2(ADAMTSL2) ELISA kit

E08A1249-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ADAMTS like protein 2(ADAMTSL2) ELISA kit

E08A1249-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Canine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ADAMTS like protein 2(ADAMTSL2) ELISA kit

E07A1249-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ADAMTS like protein 2(ADAMTSL2) ELISA kit

E07A1249-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ADAMTS like protein 2(ADAMTSL2) ELISA kit

E07A1249-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Porcine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ADAMTS like protein 2(ADAMTSL2) ELISA kit

E09A1249-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ADAMTS like protein 2(ADAMTSL2) ELISA kit

E09A1249-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ADAMTS like protein 2(ADAMTSL2) ELISA kit

E09A1249-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Monkey ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAMTS- like protein 2, ADAMTSL2 ELISA KIT

ELI-34145h 96 Tests
EUR 824

Mouse ADAMTS- like protein 2, Adamtsl2 ELISA KIT

ELI-49130m 96 Tests
EUR 865

Human ADAMTS-like protein 2(ADAMTSL2) ELISA kit

CSB-EL001318HU-24T 1 plate of 24 wells
EUR 165
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAMTS-like protein 2 (ADAMTSL2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human ADAMTS-like protein 2(ADAMTSL2) ELISA kit

  • EUR 804.00
  • EUR 5099.00
  • EUR 2704.00
  • 1 plate of 96 wells
  • 10 plates of 96 wells each
  • 5 plates of 96 wells each
  • Sample volume: 50-100ul
  • Detection wavelength: 450nm
  • Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAMTS-like protein 2(ADAMTSL2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Guinea pig ADAMTS like protein 2(ADAMTSL2) ELISA kit

E05A1249-192T 192 tests
EUR 1270
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig ADAMTS like protein 2(ADAMTSL2) ELISA kit

E05A1249-48 1 plate of 48 wells
EUR 520
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig ADAMTS like protein 2(ADAMTSL2) ELISA kit

E05A1249-96 1 plate of 96 wells
EUR 685
  • Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT
  • Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human ADAMTS-like protein 2 (ADAMTSL2)

KTE60926-48T 48T
EUR 332
  • ADAMTSL2 encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase
  • Show more
Description: Quantitative sandwich ELISA for measuring Human ADAMTS-like protein 2 (ADAMTSL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human ADAMTS-like protein 2 (ADAMTSL2)

KTE60926-5platesof96wells 5 plates of 96 wells
EUR 2115
  • ADAMTSL2 encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase
  • Show more
Description: Quantitative sandwich ELISA for measuring Human ADAMTS-like protein 2 (ADAMTSL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human ADAMTS-like protein 2 (ADAMTSL2)

KTE60926-96T 96T
EUR 539
  • ADAMTSL2 encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase
  • Show more
Description: Quantitative sandwich ELISA for measuring Human ADAMTS-like protein 2 (ADAMTSL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ADAMTSL2 Protein Vector (Human) (pPM-N-D-C-HA)

PV319924 500 ng
EUR 329

ADAMTSL2 Protein Vector (Human) (pPM-N-D-C-His)

PV319925 500 ng
EUR 329

ADAMTSL2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)

K0045605 3 x 1.0 ug
EUR 376

Adamtsl2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)

K3545805 3 x 1.0 ug
EUR 376

ADAMTSL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)

K0045606 1.0 ug DNA
EUR 167

ADAMTSL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)

K0045607 1.0 ug DNA
EUR 167

ADAMTSL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)

K0045608 1.0 ug DNA
EUR 167

Adamtsl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)

K3545806 1.0 ug DNA
EUR 167

Adamtsl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)

K3545807 1.0 ug DNA
EUR 167

Adamtsl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)

K3545808 1.0 ug DNA
EUR 167

Globally adolescents constitute over 16% but in SSA, they make up 23% of the population. While little is known about diets of these adolescents, rapid changes in physiological and social processes undergone require adequate diets.

This study aimed to determine dietary diversity and associated factors among adolescents residing in the Iganga -Mayuge HDSS.As part of the African Research, Implementation Science, and Education (ARISE) Network, we analysed collected data among 598 adolescents to assess the health status and adolescents’ behaviour.

Dietary diversity was scored using the 9 food group categories as per the Food and Agriculture Organization -WDDS. Crude and adjusted prevalence rate ratios were estimated using the modified Poisson regression model to identify associated factors.Among the participants, 45.3% had a low dietary diversity score.

Proportions of adolescents who consumed from the different food categories over a 24-h period were; cereals/roots/tubers (99.7%), fats & oils (87.0%), spices & beverages (84.1%), sweets (77.1%), legumes (66.2%), other non-vitamin A-rich vegetables (53.8%), dark green leafy vegetables (42.3%), meat/poultry/fish (33.1%), dairy products (32.9%), eggs (11.2%), vitamin A-rich fruits and vegetables (33.4%) and other fruits (8.2%).

Staying with a single parent or guardian, low socio-economic class, and dependency on home meals was associated with low dietary diversity.

Adolescents diets were low in diversity and characterised with low micronutrients source foods, but plenty of fats and oils. Interventions to address contributing factors to the burden ought to target the parenting contexts of the adolescents residing in rural eastern Uganda.