The Concentration and Probabilistic Health Risk of Potentially Toxic Elements (PTEs) in Edible Mushrooms (Wild and Cultivated) Samples Collected from Different Cities of Iran

The present study was devoted to investigate the PTE concentrations including cadmium (Cd), chromium (Cr), copper(Cu), iron (Fe), mercury (Hg), manganese (Mn), nickel (Ni), lead (Pb), arsenic(As), and zinc (Zn) among six types of edible wild, 23 cultivated mushroom samples collected from Iran’s market by the aid of an inductively coupled plasma-optical emission spectrometry (ICP-OES).

Also, the related health risk assessment was established by the aid of the Monte Carlo simulation method (MSC). The limit of detection (LOD) and limit of quantification (LOQ) were ranged 0.001-0.048 and 0.003-0.160 ppm, respectively. The concentrations of As, Cd, Cr, Cu, Fe, Hg, Mn, Ni, Pb, and Zn were determined in the ranges of 0.003-11. 5, 0.0008-5.89, 0.32-26.32, 9.15-110.08, 15.25-751.17, 0.16-2.24, 2.1-60.47, 1.21-24.22, 0.16-8.92, and 37.13-268.11 mg kg^-1, respectively.

According to findings, highest mean concentration of Cr in both types of mushrooms (cultivated and wild) was lower than recommended level by Codex Alimentarius/FoodandAgricultureOrganization/World Health Organization (CODEX/FAO/WHO) while the corresponding values for Hg (0.87 mg kg^-1), As (1.39 mg kg^-1), Ni (10.08 mg kg^-1), Cu (36.65 mg kg^-1), Cr (10.44 mg kg^-1), Cd (0.589 mg kg^-1), Fe (201.04 mg kg^-1), Mn (10.30 mg kg^-1), Zn (2266.43 mg kg^-1), and Pb (3.81 mg kg^-1) were higher than related standard levels.

According to the health risk assessment, no concern regarding the non-carcinogenic risk due to the ingestion of PTEs via the consumption of the edible mushrooms, except Hg in wild mushrooms for children, was noted.

ADAMTSL2 Antibody
36046-100ul	SAB	100ul	EUR 252

ADAMTSL2 antibody
70R-12642	Fitzgerald	100 ul	EUR 457
Description: Affinity purified Rabbit polyclonal ADAMTSL2 antibody

ADAMTSL2 Antibody
1-CSB-PA105677	Cusabio	EUR 317.00 EUR 244.00	100ul 50ul
Form: Liquid Buffer: -20°C, pH7.4 PBS, 0.05% NaN3, 40% Glycerol Antigen affinity purification
Description: A polyclonal antibody against ADAMTSL2. Recognizes ADAMTSL2 from Human, Mouse. This antibody is Unconjugated. Tested in the following application: ELISA, WB;ELISA:1:1000-1:2000, WB:1:200-1:1000

ADAMTSL2 Conjugated Antibody
C36046	SAB	100ul	EUR 397

ADAMTSL2 cloning plasmid
CSB-CL801225HU-10ug	Cusabio	10ug	EUR 558
Formulation: 10 μg plasmid + 200μl Glycerol Length: 2856 Sequence: atggatggcagatggcaatgttcctgctgggcctggttcctgctggttctggcagttgtagctggggacacagtgtcaaccgggtccacggacaacagcccaacatccaatagcctggaggggggcaccgacgccacggccttctggtggggggagtggaccaagtggacggcgt Show more
Description: A cloning plasmid for the ADAMTSL2 gene.

Anti-ADAMTSL2 antibody
STJ72031	St John's Laboratory	100 µg	EUR 260

Mouse ADAMTSL2 shRNA Plasmid
20-abx978830	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Human ADAMTSL2 shRNA Plasmid
20-abx956487	Abbexa	EUR 801.00 EUR 1121.00	150 µg 300 µg
Shipped within 15-20 working days.

Polyclonal ADAMTSL2 Antibody (internal region)
APR14827G	Leading Biology	0.1 mg	EUR 484
Description: A polyclonal antibody raised in Goat that recognizes and binds to Human ADAMTSL2 (internal region). This antibody is tested and proven to work in the following applications:

ADAMTS Like 2 (ADAMTSL2) Antibody
abx432208-200ul	Abbexa	200 ul	EUR 286
Shipped within 1-3 working days.

ADAMTS Like 2 (ADAMTSL2) Antibody
20-abx211972	Abbexa	EUR 411.00 EUR 300.00	100 ul 50 ul
Shipped within 5-10 working days.

ADAMTSL2 ORF Vector (Human) (pORF)
ORF000182	ABM	1.0 ug DNA	EUR 95

Adamtsl2 ORF Vector (Mouse) (pORF)
ORF038119	ABM	1.0 ug DNA	EUR 506

ADAMTSL2 ELISA Kit (Human) (OKCA01094)
OKCA01094	Aviva Systems Biology	96 Wells	EUR 846
Description: Description of target: This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The protein encoded by this gene lacks the protease domain, and is therefore of a member of the the ADAMTS-like protein subfamily. It is a secreted glycoprotein that binds the cell surface and extracellular matrix; it also interacts with latent transforming growth factor beta binding protein 1. Mutations in this gene have been associated with geleophysic dysplasia.;Species reactivity: Human;Application: ;Assay info: Assay Methodology: Quantitative Sanadwich ELISA;Sensitivity: 0.78 ng/mL

ADAMTSL2 sgRNA CRISPR Lentivector set (Human)
K0045601	ABM	3 x 1.0 ug	EUR 339

Adamtsl2 sgRNA CRISPR Lentivector set (Mouse)
K3545801	ABM	3 x 1.0 ug	EUR 339

ADAMTSL2 sgRNA CRISPR Lentivector (Human) (Target 1)
K0045602	ABM	1.0 ug DNA	EUR 154

ADAMTSL2 sgRNA CRISPR Lentivector (Human) (Target 2)
K0045603	ABM	1.0 ug DNA	EUR 154

ADAMTSL2 sgRNA CRISPR Lentivector (Human) (Target 3)
K0045604	ABM	1.0 ug DNA	EUR 154

Adamtsl2 sgRNA CRISPR Lentivector (Mouse) (Target 1)
K3545802	ABM	1.0 ug DNA	EUR 154

Adamtsl2 sgRNA CRISPR Lentivector (Mouse) (Target 2)
K3545803	ABM	1.0 ug DNA	EUR 154

Adamtsl2 sgRNA CRISPR Lentivector (Mouse) (Target 3)
K3545804	ABM	1.0 ug DNA	EUR 154

ADAMTSL2 Protein Vector (Human) (pPB-C-His)
PV000725	ABM	500 ng	EUR 329

ADAMTSL2 Protein Vector (Human) (pPB-N-His)
PV000726	ABM	500 ng	EUR 329

ADAMTSL2 Protein Vector (Human) (pPM-C-HA)
PV000727	ABM	500 ng	EUR 329

ADAMTSL2 Protein Vector (Human) (pPM-C-His)
PV000728	ABM	500 ng	EUR 329

ADAMTSL2 Protein Vector (Human) (pPB-His-MBP)
PV319922	ABM	500 ng	EUR 329

ADAMTSL2 Protein Vector (Human) (pPB-His-GST)
PV319923	ABM	500 ng	EUR 329

ADAMTSL2 Protein Vector (Mouse) (pPB-C-His)
PV152474	ABM	500 ng	EUR 1065

ADAMTSL2 Protein Vector (Mouse) (pPB-N-His)
PV152475	ABM	500 ng	EUR 1065

ADAMTSL2 Protein Vector (Mouse) (pPM-C-HA)
PV152476	ABM	500 ng	EUR 1065

ADAMTSL2 Protein Vector (Mouse) (pPM-C-His)
PV152477	ABM	500 ng	EUR 1065

Adamtsl2 3'UTR Luciferase Stable Cell Line
TU200287	ABM	1.0 ml	Ask for price

Adamtsl2 3'UTR GFP Stable Cell Line
TU151404	ABM	1.0 ml	Ask for price

ADAMTSL2 3'UTR Luciferase Stable Cell Line
TU000336	ABM	1.0 ml	EUR 1394

Adamtsl2 3'UTR Luciferase Stable Cell Line
TU101404	ABM	1.0 ml	Ask for price

ADAMTSL2 3'UTR GFP Stable Cell Line
TU050336	ABM	1.0 ml	EUR 1394

Adamtsl2 3'UTR GFP Stable Cell Line
TU250287	ABM	1.0 ml	Ask for price

Goat ADAMTS like protein 2(ADAMTSL2) ELISA kit
E06A1249-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat ADAMTS like protein 2(ADAMTSL2) ELISA kit
E06A1249-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Goat ADAMTS like protein 2(ADAMTSL2) ELISA kit
E06A1249-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Goat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ADAMTS like protein 2(ADAMTSL2) ELISA kit
E02A1249-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ADAMTS like protein 2(ADAMTSL2) ELISA kit
E02A1249-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rat ADAMTS like protein 2(ADAMTSL2) ELISA kit
E02A1249-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rat ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ADAMTS like protein 2(ADAMTSL2) ELISA kit
E03A1249-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ADAMTS like protein 2(ADAMTSL2) ELISA kit
E03A1249-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Mouse ADAMTS like protein 2(ADAMTSL2) ELISA kit
E03A1249-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Mouse ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ADAMTS like protein 2(ADAMTSL2) ELISA kit
E04A1249-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ADAMTS like protein 2(ADAMTSL2) ELISA kit
E04A1249-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Rabbit ADAMTS like protein 2(ADAMTSL2) ELISA kit
E04A1249-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Rabbit ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAMTS like protein 2(ADAMTSL2) ELISA kit
E01A1249-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAMTS like protein 2(ADAMTSL2) ELISA kit
E01A1249-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAMTS like protein 2(ADAMTSL2) ELISA kit
E01A1249-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Human ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ADAMTS like protein 2(ADAMTSL2) ELISA kit
E08A1249-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ADAMTS like protein 2(ADAMTSL2) ELISA kit
E08A1249-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Dog ADAMTS like protein 2(ADAMTSL2) ELISA kit
E08A1249-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Canine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ADAMTS like protein 2(ADAMTSL2) ELISA kit
E07A1249-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ADAMTS like protein 2(ADAMTSL2) ELISA kit
E07A1249-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Pig ADAMTS like protein 2(ADAMTSL2) ELISA kit
E07A1249-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Porcine ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ADAMTS like protein 2(ADAMTSL2) ELISA kit
E09A1249-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ADAMTS like protein 2(ADAMTSL2) ELISA kit
E09A1249-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Monkey ADAMTS like protein 2(ADAMTSL2) ELISA kit
E09A1249-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Monkey ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Human ADAMTS- like protein 2, ADAMTSL2 ELISA KIT
ELI-34145h	Lifescience Market	96 Tests	EUR 824

Mouse ADAMTS- like protein 2, Adamtsl2 ELISA KIT
ELI-49130m	Lifescience Market	96 Tests	EUR 865

Human ADAMTS-like protein 2(ADAMTSL2) ELISA kit
CSB-EL001318HU-24T	Cusabio	1 plate of 24 wells	EUR 165
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAMTS-like protein 2 (ADAMTSL2) in samples from serum, plasma, tissue homogenates. A new trial version of the kit, which allows you to test the kit in your application at a reasonable price.

Human ADAMTS-like protein 2(ADAMTSL2) ELISA kit
1-CSB-EL001318HU	Cusabio	EUR 804.00 EUR 5099.00 EUR 2704.00	1 plate of 96 wells 10 plates of 96 wells each 5 plates of 96 wells each
Sample volume: 50-100ul Detection wavelength: 450nm Assay performance time: 1 to 4 hours.
Description: Quantitativesandwich ELISA kit for measuring Human ADAMTS-like protein 2(ADAMTSL2) in samples from serum, plasma, tissue homogenates. Now available in a cost efficient pack of 5 plates of 96 wells each, conveniently packed along with the other reagents in 5 separate kits.

Guinea pig ADAMTS like protein 2(ADAMTSL2) ELISA kit
E05A1249-192T	B-Gene	192 tests	EUR 1270
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig ADAMTS like protein 2(ADAMTSL2) ELISA kit
E05A1249-48	B-Gene	1 plate of 48 wells	EUR 520
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

Guinea pig ADAMTS like protein 2(ADAMTSL2) ELISA kit
E05A1249-96	B-Gene	1 plate of 96 wells	EUR 685
Kit contents: 1. MICROTITER PLATE * 1 2. ENZYME CONJUGATE*1 vial 3. STANDARD A*1 vial 4. STANDARD B*1 vial 5. STANDARD C*1 vial 6. STANDARD D*1 vial 7. STANDARD E*1 vial 8. STANDARD F*1 vial 9. SUBSTRATE A*1 vial 10. SUBSTRATE B*1 vial 11. STOP SOLUT Show more
Description: A competitive ELISA for quantitative measurement of Guinea pig ADAMTS like protein 2(ADAMTSL2) in samples from blood, plasma, serum, cell culture supernatant and other biological fluids. This is a high quality ELISA kit developped for optimal performance with samples from the particular species.

ELISA kit for Human ADAMTS-like protein 2 (ADAMTSL2)
KTE60926-48T	Abbkine	48T	EUR 332
ADAMTSL2 encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase Show more
Description: Quantitative sandwich ELISA for measuring Human ADAMTS-like protein 2 (ADAMTSL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human ADAMTS-like protein 2 (ADAMTSL2)
KTE60926-5platesof96wells	Abbkine	5 plates of 96 wells	EUR 2115
ADAMTSL2 encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase Show more
Description: Quantitative sandwich ELISA for measuring Human ADAMTS-like protein 2 (ADAMTSL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ELISA kit for Human ADAMTS-like protein 2 (ADAMTSL2)
KTE60926-96T	Abbkine	96T	EUR 539
ADAMTSL2 encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) and ADAMTS-like protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase Show more
Description: Quantitative sandwich ELISA for measuring Human ADAMTS-like protein 2 (ADAMTSL2) in samples from cell culture supernatants, serum, whole blood, plasma and other biological fluids.

ADAMTSL2 Protein Vector (Human) (pPM-N-D-C-HA)
PV319924	ABM	500 ng	EUR 329

ADAMTSL2 Protein Vector (Human) (pPM-N-D-C-His)
PV319925	ABM	500 ng	EUR 329

ADAMTSL2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Human)
K0045605	ABM	3 x 1.0 ug	EUR 376

Adamtsl2 sgRNA CRISPR/Cas9 All-in-One Lentivector set (Mouse)
K3545805	ABM	3 x 1.0 ug	EUR 376

ADAMTSL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 1)
K0045606	ABM	1.0 ug DNA	EUR 167

ADAMTSL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 2)
K0045607	ABM	1.0 ug DNA	EUR 167

ADAMTSL2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Human) (Target 3)
K0045608	ABM	1.0 ug DNA	EUR 167

Adamtsl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 1)
K3545806	ABM	1.0 ug DNA	EUR 167

Adamtsl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 2)
K3545807	ABM	1.0 ug DNA	EUR 167

Adamtsl2 sgRNA CRISPR/Cas9 All-in-One Lentivector (Mouse) (Target 3)
K3545808	ABM	1.0 ug DNA	EUR 167

Globally adolescents constitute over 16% but in SSA, they make up 23% of the population. While little is known about diets of these adolescents, rapid changes in physiological and social processes undergone require adequate diets.

This study aimed to determine dietary diversity and associated factors among adolescents residing in the Iganga -Mayuge HDSS.As part of the African Research, Implementation Science, and Education (ARISE) Network, we analysed collected data among 598 adolescents to assess the health status and adolescents’ behaviour.

Dietary diversity was scored using the 9 food group categories as per the Food and Agriculture Organization -WDDS. Crude and adjusted prevalence rate ratios were estimated using the modified Poisson regression model to identify associated factors.Among the participants, 45.3% had a low dietary diversity score.

Proportions of adolescents who consumed from the different food categories over a 24-h period were; cereals/roots/tubers (99.7%), fats & oils (87.0%), spices & beverages (84.1%), sweets (77.1%), legumes (66.2%), other non-vitamin A-rich vegetables (53.8%), dark green leafy vegetables (42.3%), meat/poultry/fish (33.1%), dairy products (32.9%), eggs (11.2%), vitamin A-rich fruits and vegetables (33.4%) and other fruits (8.2%).

Staying with a single parent or guardian, low socio-economic class, and dependency on home meals was associated with low dietary diversity.

Adolescents diets were low in diversity and characterised with low micronutrients source foods, but plenty of fats and oils. Interventions to address contributing factors to the burden ought to target the parenting contexts of the adolescents residing in rural eastern Uganda.